Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTGAGATGCACCGCGCAGGCCCACC[C/T]CCTCTCCGAGCAGCCCCACTTCTGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610215 MIM: 613142 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ARHGEF25 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ARHGEF25 - Rho guanine nucleotide exchange factor 25 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DTX3 - deltex E3 ubiquitin ligase 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286245.1 | 1061 | Silent Mutation | CCC,CCT | P,P 126 | NP_001273174.1 | |
NM_001286246.1 | 1061 | Silent Mutation | CCC,CCT | P,P 123 | NP_001273175.1 | |
NM_178502.3 | 1061 | Silent Mutation | CCC,CCT | P,P 123 | NP_848597.1 | |
XM_005268697.1 | 1061 | Silent Mutation | CCC,CCT | P,P 126 | XP_005268754.1 | |
XM_005268698.1 | 1061 | Silent Mutation | CCC,CCT | P,P 126 | XP_005268755.1 | |
XM_005268700.1 | 1061 | Silent Mutation | CCC,CCT | P,P 126 | XP_005268757.1 | |
XM_005268703.1 | 1061 | Silent Mutation | CCC,CCT | P,P 123 | XP_005268760.1 | |
XM_011538022.2 | 1061 | Silent Mutation | CCC,CCT | P,P 123 | XP_011536324.1 |
PIP4K2C - phosphatidylinositol-5-phosphate 4-kinase type 2 gamma | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |