Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TATCAGAGCAACTGGATTTTATCAA[A/G]ATAACACTCTAAATACTGCACCTGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611326 MIM: 608706 | ||||||||||||||||||||
Literature Links: |
C15orf65 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
C15orf65 - chromosome 15 open reading frame 65 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001198784.1 | 539 | Missense Mutation | AAT,GAT | N,D 99 | NP_001185713.1 |
CCPG1 - cell cycle progression 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DYX1C1 - dyslexia susceptibility 1 candidate 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001033559.2 | 539 | Intron | NP_001028731.1 | |||
NM_001033560.1 | 539 | Intron | NP_001028732.1 | |||
NM_130810.3 | 539 | Intron | NP_570722.2 |
DYX1C1-CCPG1 - DYX1C1-CCPG1 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |