Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CATATTTCCAGCCCAAAGTGGTCTT[A/G]CAGTTCTCGCAGTGGATGTCGGCGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616318 MIM: 602035 MIM: 602427 MIM: 609724 | ||||||||||||||||||||
Literature Links: |
GDPD3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GDPD3 - glycerophosphodiester phosphodiesterase domain containing 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101928595 - uncharacterized LOC101928595 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPP4C - protein phosphatase 4 catalytic subunit | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TBX6 - T-box 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
YPEL3 - yippee like 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001145524.1 | 432 | Silent Mutation | TGC,TGT | C,C 82 | NP_001138996.1 | |
NM_031477.4 | 432 | Silent Mutation | TGC,TGT | C,C 120 | NP_113665.3 |