Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGAGGGTGATGAGGACGACAGCCAC[A/G]TCCGGGCCCAGCAGGCCTGCATTGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603264 MIM: 613889 MIM: 607207 | ||||||||||||||||||||
Literature Links: |
JMJD8 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
JMJD8 - jumonji domain containing 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001005920.2 | 1866 | UTR 3 | NP_001005920.2 | |||
NM_001323918.1 | 1866 | UTR 3 | NP_001310847.1 | |||
NM_001323919.1 | 1866 | UTR 3 | NP_001310848.1 | |||
NM_001323920.1 | 1866 | UTR 3 | NP_001310849.1 | |||
NM_001323922.1 | 1866 | UTR 3 | NP_001310851.1 |
LOC105371184 - uncharacterized LOC105371184 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RHBDL1 - rhomboid like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RHOT2 - ras homolog family member T2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
STUB1 - STIP1 homology and U-box containing protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001293197.1 | 1866 | Missense Mutation | ATC,GTC | I,V 121 | NP_001280126.1 | |
NM_005861.3 | 1866 | Missense Mutation | ATC,GTC | I,V 193 | NP_005852.2 |
WDR24 - WD repeat domain 24 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |