Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGAAGGCAGGTAGCCCTTGGGGTT[A/G]TTGCCCTTGTCTGTGTTCTGGCGGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607300 MIM: 607848 MIM: 607873 | ||||||||||||||||||||
Literature Links: |
PRPF8 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
PRPF8 - pre-mRNA processing factor 8 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006445.3 | 6852 | Silent Mutation | AAC,AAT | N,N 2246 | NP_006436.3 |
RILP - Rab interacting lysosomal protein | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SCARF1 - scavenger receptor class F member 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |