Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGTACCTTTCTGTCAGGTAGCTGAT[A/G]AAGTCCGGATGTAGCAGCTTGAATT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610137 | ||||||||||||||||||||
Literature Links: |
SNHG16 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
SNHG16 - small nucleolar RNA host gene 16 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD1A - small nucleolar RNA, C/D box 1A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD1B - small nucleolar RNA, C/D box 1B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD1C - small nucleolar RNA, C/D box 1C | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ST6GALNAC2 - ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006456.2 | 1092 | Silent Mutation | TTC,TTT | F,F 279 | NP_006447.2 | |
XM_005256954.3 | 1092 | Intron | XP_005257011.1 |