Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTCTGATGTTTAAGAAAAGCTGTGC[A/G]CCCACTGAAGGTCTTCCCACATCTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604334 | ||||||||||||||||||||
Literature Links: |
LOC100130950 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
LOC100130950 - uncharacterized LOC100130950 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
USP6 - ubiquitin specific peptidase 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF594 - zinc finger protein 594 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_032530.1 | 1472 | Missense Mutation | NP_115919.1 | |||
XM_005256827.2 | 1472 | Missense Mutation | XP_005256884.1 |