Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGATTGCGCCCAACTTCGTCATGTC[G/T]GCCGCGCACTGCGTGGCGAATGTGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 134350 MIM: 130130 MIM: 177020 | ||||||||||||||||||||
Literature Links: |
CFD PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CFD - complement factor D | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ELANE - elastase, neutrophil expressed | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001972.3 | 337 | Silent Mutation | TCG,TCT | S,S 67 | NP_001963.1 | |
XM_011527775.1 | 337 | Silent Mutation | TCG,TCT | S,S 67 | XP_011526077.1 | |
XM_011527776.1 | 337 | Silent Mutation | TCG,TCT | S,S 67 | XP_011526078.1 |
PRTN3 - proteinase 3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |