Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCTGGTGCTGAATGAGCTTGGTGCT[C/G]TGGTGGAAGCGGCGGCCACAGTCCT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 610893 MIM: 194550 MIM: 603173 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CHMP2A PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CHMP2A - charged multivesicular body protein 2A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MZF1 - myeloid zinc finger 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001267033.1 | 3076 | UTR 3 | NP_001253962.1 | |||
NM_003422.2 | 3076 | Missense Mutation | CAC,CAG | H,Q 720 | NP_003413.2 | |
NM_198055.1 | 3076 | Missense Mutation | CAC,CAG | H,Q 720 | NP_932172.1 | |
XM_005259204.3 | 3076 | Missense Mutation | CAC,CAG | H,Q 761 | XP_005259261.1 | |
XM_011527264.2 | 3076 | Missense Mutation | CAC,CAG | H,Q 750 | XP_011525566.1 | |
XM_017027206.1 | 3076 | Missense Mutation | CAC,CAG | H,Q 436 | XP_016882695.1 |
MZF1-AS1 - MZF1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UBE2M - ubiquitin conjugating enzyme E2 M | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |