Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCGCTGTGGCCCCATCCGCATCCTG[C/T]GCATTCACATCAGCCCCACACGCCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614611 MIM: 602139 MIM: 603685 | ||||||||||||||||||||
Literature Links: |
KANK3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
KANK3 - KN motif and ankyrin repeat domains 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_198471.2 | 2238 | Silent Mutation | GCA,GCG | A,A 724 | NP_940873.2 | |
XM_006722718.3 | 2238 | Silent Mutation | GCA,GCG | A,A 724 | XP_006722781.1 | |
XM_011527884.2 | 2238 | Silent Mutation | GCA,GCG | A,A 724 | XP_011526186.1 | |
XM_017026563.1 | 2238 | Silent Mutation | GCA,GCG | A,A 775 | XP_016882052.1 |
NDUFA7 - NADH:ubiquinone oxidoreductase subunit A7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RPS28 - ribosomal protein S28 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |