Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAACCACTGGGCTCCCTTTGAACCC[A/G]GCCCAATCTTTGGTCCCAGCATTTT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
13 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 107670 MIM: 603881 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
APOA2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
APOA2 - apolipoprotein A2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR5187 - microRNA 5187 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TOMM40L - translocase of outer mitochondrial membrane 40 like | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001286373.1 | 1878 | UTR 3 | NP_001273302.1 | |||
NM_001286374.1 | 1878 | UTR 3 | NP_001273303.1 | |||
NM_032174.5 | 1878 | UTR 3 | NP_115550.2 | |||
XM_006711572.2 | 1878 | UTR 3 | XP_006711635.1 | |||
XM_011510057.2 | 1878 | UTR 3 | XP_011508359.1 | |||
XM_017002481.1 | 1878 | UTR 3 | XP_016857970.1 | |||
XM_017002482.1 | 1878 | UTR 3 | XP_016857971.1 |