Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGGGGCCCAGGGCTGAGGCAGTGGG[C/T]GGCAGTCCATGGGCAGTAATGTACT
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 608095 MIM: 605834 MIM: 600607 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
SCNM1 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
SCNM1 - sodium channel modifier 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMOD4 - tropomodulin 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_013353.2 | 1091 | Intron | NP_037485.2 | |||
XM_011509449.1 | 1091 | Intron | XP_011507751.1 | |||
XM_017001089.1 | 1091 | Intron | XP_016856578.1 | |||
XM_017001090.1 | 1091 | Intron | XP_016856579.1 |
TNFAIP8L2-SCNM1 - TNFAIP8L2-SCNM1 readthrough | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VPS72 - vacuolar protein sorting 72 homolog | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001271087.1 | 1091 | Silent Mutation | CCA,CCG | P,P 344 | NP_001258016.1 | |
NM_001271088.1 | 1091 | UTR 3 | NP_001258017.1 | |||
NM_005997.2 | 1091 | Silent Mutation | CCA,CCG | P,P 333 | NP_005988.1 | |
XM_017002205.1 | 1091 | Silent Mutation | CCA,CCG | P,P 212 | XP_016857694.1 |