Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCGGTCTCACTTTCACCCTCAAAGA[A/G]CTGGTGAAGACTTTCAGGCTCAATT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 614787 MIM: 602177 | ||||||||||||||||||||
Literature Links: |
POGZ PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
POGZ - pogo transposable element with ZNF domain | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001194937.1 | 5033 | Missense Mutation | CTC,TTC | L,F 1378 | NP_001181866.1 | |
NM_001194938.1 | 5033 | Missense Mutation | CTC,TTC | L,F 1325 | NP_001181867.1 | |
NM_015100.3 | 5033 | Missense Mutation | CTC,TTC | L,F 1387 | NP_055915.2 | |
NM_145796.3 | 5033 | Missense Mutation | CTC,TTC | L,F 1292 | NP_665739.3 | |
NM_207171.2 | 5033 | Missense Mutation | CTC,TTC | L,F 1334 | NP_997054.1 | |
XM_005244999.2 | 5033 | Missense Mutation | CTC,TTC | L,F 1387 | XP_005245056.1 | |
XM_005245000.4 | 5033 | Missense Mutation | CTC,TTC | L,F 1387 | XP_005245057.1 | |
XM_005245001.2 | 5033 | Missense Mutation | CTC,TTC | L,F 1387 | XP_005245058.1 | |
XM_005245005.1 | 5033 | Missense Mutation | CTC,TTC | L,F 1334 | XP_005245062.1 | |
XM_005245006.4 | 5033 | Missense Mutation | CTC,TTC | L,F 1334 | XP_005245063.1 | |
XM_011509331.2 | 5033 | Missense Mutation | CTC,TTC | L,F 1268 | XP_011507633.1 | |
XM_017000744.1 | 5033 | Missense Mutation | CTC,TTC | L,F 1394 | XP_016856233.1 | |
XM_017000745.1 | 5033 | Missense Mutation | CTC,TTC | L,F 1378 | XP_016856234.1 | |
XM_017000746.1 | 5033 | Missense Mutation | CTC,TTC | L,F 1378 | XP_016856235.1 | |
XM_017000747.1 | 5033 | Missense Mutation | CTC,TTC | L,F 1338 | XP_016856236.1 | |
XM_017000748.1 | 5033 | Missense Mutation | CTC,TTC | L,F 1334 | XP_016856237.1 | |
XM_017000749.1 | 5033 | Missense Mutation | CTC,TTC | L,F 1334 | XP_016856238.1 |
PSMB4 - proteasome subunit beta 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |