Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GGCATGAGGACACTCACCACACTCT[C/T]GCATGACCTGGTAGGTCTTGGACTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600564 | ||||||||||||||||||||
Literature Links: |
ITIH4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ITIH4 - inter-alpha-trypsin inhibitor heavy chain family member 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ITIH4-AS1 - ITIH4 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MUSTN1 - musculoskeletal, embryonic nuclear protein 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_205853.3 | 1135 | Missense Mutation | CAA,CGA | Q,R 45 | NP_995325.3 |
TMEM110 - transmembrane protein 110 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TMEM110-MUSTN1 - TMEM110-MUSTN1 readthrough | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001198974.2 | 1135 | Missense Mutation | CAA,CGA | Q,R 335 | NP_001185903.2 |