Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATGATCGTGAGGCTCATAATGAGGT[A/C]GAACCACTTTGCATCCTGGACTTTT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615556 MIM: 611982 MIM: 603771 | ||||||||||||||||||||
Literature Links: |
ATAT1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ATAT1 - alpha tubulin acetyltransferase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001031722.3 | 392 | Silent Mutation | GTA,GTC | V,V 104 | NP_001026892.1 | |
NM_001190724.2 | 392 | Silent Mutation | GTA,GTC | V,V 104 | NP_001177653.1 | |
NM_001254952.2 | 392 | Silent Mutation | GTA,GTC | V,V 116 | NP_001241881.1 | |
NM_001318762.1 | 392 | Silent Mutation | GTA,GTC | V,V 116 | NP_001305691.1 | |
NM_001318763.1 | 392 | Silent Mutation | GTA,GTC | V,V 116 | NP_001305692.1 | |
NM_024909.3 | 392 | Silent Mutation | GTA,GTC | V,V 116 | NP_079185.2 | |
XM_005249415.2 | 392 | Silent Mutation | GTA,GTC | V,V 104 | XP_005249472.1 | |
XM_011514918.2 | 392 | Intron | XP_011513220.1 | |||
XM_017011316.1 | 392 | Silent Mutation | GTA,GTC | V,V 104 | XP_016866805.1 |
MRPS18B - mitochondrial ribosomal protein S18B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPP1R10 - protein phosphatase 1 regulatory subunit 10 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |