Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGGCAGCTGCTGTGGCTCCAGGATG[A/G]TGGAGACAGAGCGACTTGGTGAGGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 138470 MIM: 154040 MIM: 600478 | ||||||||||||||||||||
Literature Links: |
CFB PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CFB - complement factor B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR1236 - microRNA 1236 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NELFE - negative elongation factor complex member E | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002904.5 | 393 | Intron | NP_002895.3 | |||
XM_006715205.3 | 393 | Intron | XP_006715268.1 | |||
XM_011514913.2 | 393 | Intron | XP_011513215.1 | |||
XM_017011299.1 | 393 | Intron | XP_016866788.1 |
SKIV2L - Ski2 like RNA helicase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006929.4 | 393 | Missense Mutation | ATG,GTG | M,V 2 | NP_008860.4 | |
XM_011514815.2 | 393 | Missense Mutation | ATG,GTG | M,V 2 | XP_011513117.1 |