Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGACTGGTTAAATGGAAAGCCCCCC[A/G]AGCCTGAAGGCTGGGCTGAGGCTGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603948 | ||||||||||||||||||||
Literature Links: |
FAM8A1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM8A1 - family with sequence similarity 8 member A1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NUP153 - nucleoporin 153 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001278209.1 | 4838 | Missense Mutation | TCG,TTG | S,L 1464 | NP_001265138.1 | |
NM_001278210.1 | 4838 | Missense Mutation | TCG,TTG | S,L 1391 | NP_001265139.1 | |
NM_005124.3 | 4838 | Missense Mutation | TCG,TTG | S,L 1433 | NP_005115.2 | |
XM_005249507.2 | 4838 | Missense Mutation | TCG,TTG | S,L 1415 | XP_005249564.1 | |
XM_006715290.2 | 4838 | Missense Mutation | TCG,TTG | S,L 1427 | XP_006715353.1 | |
XM_006715291.3 | 4838 | Intron | XP_006715354.1 | |||
XM_011515028.2 | 4838 | Missense Mutation | TCG,TTG | S,L 1368 | XP_011513330.1 | |
XM_017011594.1 | 4838 | Missense Mutation | TCG,TTG | S,L 1409 | XP_016867083.1 |