Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGCCGAGATGCGTACTTGGAAGCCC[A/C]GTCTGTCCGGCCATGCACTGGCTGG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 605450 MIM: 612325 MIM: 606515 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
GSTA4 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
GSTA4 - glutathione S-transferase alpha 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ICK - intestinal cell (MAK-like) kinase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_014920.3 | 3050 | Missense Mutation | GGG,TGG | G,W 624 | NP_055735.1 | |
NM_016513.4 | 3050 | Missense Mutation | GGG,TGG | G,W 624 | NP_057597.2 | |
XM_011514419.1 | 3050 | Missense Mutation | GGG,TGG | G,W 631 | XP_011512721.1 | |
XM_011514420.2 | 3050 | Missense Mutation | GGG,TGG | G,W 631 | XP_011512722.1 | |
XM_011514421.1 | 3050 | Missense Mutation | GGG,TGG | G,W 631 | XP_011512723.1 | |
XM_017010485.1 | 3050 | Missense Mutation | GGG,TGG | G,W 631 | XP_016865974.1 | |
XM_017010486.1 | 3050 | Missense Mutation | GGG,TGG | G,W 631 | XP_016865975.1 | |
XM_017010487.1 | 3050 | Missense Mutation | GGG,TGG | G,W 631 | XP_016865976.1 | |
XM_017010488.1 | 3050 | Missense Mutation | GGG,TGG | G,W 624 | XP_016865977.1 | |
XM_017010489.1 | 3050 | Missense Mutation | GGG,TGG | G,W 624 | XP_016865978.1 | |
XM_017010490.1 | 3050 | Missense Mutation | GGG,TGG | G,W 624 | XP_016865979.1 | |
XM_017010491.1 | 3050 | Missense Mutation | GGG,TGG | G,W 624 | XP_016865980.1 | |
XM_017010492.1 | 3050 | Missense Mutation | GGG,TGG | G,W 624 | XP_016865981.1 |
RN7SK - RNA, 7SK small nuclear | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |