Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAATTCTTCATTTTGGAATCATCCA[A/G]GAAAAGCTGCAGATAGAGGGCCAGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 615880 | ||||||||||||||||||||
Literature Links: |
ARHGAP39 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ARHGAP39 - Rho GTPase activating protein 39 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
C8orf82 - chromosome 8 open reading frame 82 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001001795.1 | 321 | Silent Mutation | CTG,TTG | L,L 55 | NP_001001795.1 |
LRRC14 - leucine rich repeat containing 14 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRRC24 - leucine rich repeat containing 24 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |