Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGGCCAGGGCAGCCTCGGAGGTGC[G/A]TGCCCGCCTTGGGAACCCCAGAGGA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
8 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 608507 MIM: 608772 | ||||||||||||||||||||
Literature Links: |
MFN2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
MFN2 - mitofusin 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIIP - migration and invasion inhibitory protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_021933.3 | Intron | NP_068752.2 | ||||
XM_005263487.3 | Intron | XP_005263544.1 | ||||
XM_011541895.1 | Intron | XP_011540197.1 | ||||
XM_011541896.1 | Intron | XP_011540198.1 |
MIR6729 - microRNA 6729 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |