Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ATTGCAAGGACAGGTTCCAAGGTAA[G/A]CAACACTAAAGTAATACTAAATTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
4 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 612375 | ||||||||||||||||||||
Literature Links: |
AIDA PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
AIDA - axin interactor, dorsalization associated | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
BROX - BRO1 domain and CAAX motif containing | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001288579.1 | Intron | NP_001275508.1 | ||||
NM_001288580.1 | Intron | NP_001275509.1 | ||||
NM_001288581.1 | Intron | NP_001275510.1 | ||||
NM_144695.3 | Intron | NP_653296.2 | ||||
XM_005273065.2 | Intron | XP_005273122.2 | ||||
XM_005273069.4 | Intron | XP_005273126.1 | ||||
XM_006711173.3 | Intron | XP_006711236.1 | ||||
XM_011509212.2 | Intron | XP_011507514.1 | ||||
XM_011509213.2 | Intron | XP_011507515.1 | ||||
XM_011509214.2 | Intron | XP_011507516.1 | ||||
XM_017000374.1 | Intron | XP_016855863.1 | ||||
XM_017000375.1 | Intron | XP_016855864.1 | ||||
XM_017000376.1 | Intron | XP_016855865.1 |