Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGGCATCTCCATGCAGAGGACAAG[A/G]TCTCACTTTTGCTACCAAGGAGAGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
SNORD116-2 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
SNORD116-2 - small nucleolar RNA, C/D box 116-2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116-3 - small nucleolar RNA, C/D box 116-3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116-4 - small nucleolar RNA, C/D box 116-4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116-5 - small nucleolar RNA, C/D box 116-5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116-6 - small nucleolar RNA, C/D box 116-6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116-7 - small nucleolar RNA, C/D box 116-7 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116-8 - small nucleolar RNA, C/D box 116-8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD116@ - small nucleolar RNA, C/D box 116 cluster | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |