Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGGTTTCAAAAAAGAGTTGACTGT[A/G]TGAACAATCCATTTAGAGGAGCTAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 616747 MIM: 607840 MIM: 604759 | ||||||||||||||||||||
Literature Links: |
CHPT1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CHPT1 - choline phosphotransferase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020244.2 | Intron | NP_064629.2 | ||||
XM_011538574.1 | Intron | XP_011536876.1 | ||||
XM_011538575.1 | Intron | XP_011536877.1 |
GNPTAB - N-acetylglucosamine-1-phosphate transferase alpha and beta subunits | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SYCP3 - synaptonemal complex protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001177948.1 | Intron | NP_001171419.1 | ||||
NM_001177949.1 | Intron | NP_001171420.1 | ||||
NM_153694.4 | Intron | NP_710161.1 | ||||
XM_005268922.4 | Intron | XP_005268979.3 | ||||
XM_005268924.1 | Intron | XP_005268981.1 | ||||
XM_005268925.1 | Intron | XP_005268982.1 | ||||
XM_005268926.3 | Intron | XP_005268983.1 | ||||
XM_005268927.2 | Intron | XP_005268984.1 | ||||
XM_011538421.2 | Intron | XP_011536723.2 | ||||
XM_017019368.1 | Intron | XP_016874857.1 |