Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGACCACTATCCTTTCAATGAAGC[A/C]TGGGTATCTGGCCTTCCTCCAGGTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607366 MIM: 609309 | ||||||||||||||||||||
Literature Links: |
HCG2040054 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HCG2040054 - uncharacterized LOC644093 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KCNK12 - potassium two pore domain channel subfamily K member 12 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MSH2 - mutS homolog 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000251.2 | Intron | NP_000242.1 | ||||
NM_001258281.1 | Intron | NP_001245210.1 | ||||
XM_005264332.3 | Intron | XP_005264389.2 | ||||
XM_011532867.1 | Intron | XP_011531169.1 |