Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCGGGCCCGGGCCGGCCTCCCTCT[C/T]GCAGGTGCCGTCGTGATGGAGAAGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606979 MIM: 600027 MIM: 609982 | ||||||||||||||||||||
Literature Links: |
COG8 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
COG8 - component of oligomeric golgi complex 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PDF - peptide deformylase (mitochondrial) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNTB2 - syntrophin beta 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
VPS4A - vacuolar protein sorting 4 homolog A | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_013245.2 | Intron | NP_037377.1 |