Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GATCTGCAAGTAGAGGACAAAGACA[C/T]TACCGCCCATTCCAGCCACTGGTTC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
9 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 602989 MIM: 606913 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
CLK2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
CLK2 - CDC like kinase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FAM189B - family with sequence similarity 189 member B | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001267608.1 | Intron | NP_001254537.1 | ||||
NM_006589.2 | Intron | NP_006580.2 | ||||
NM_198264.1 | Intron | NP_937995.1 | ||||
XM_005244845.1 | Intron | XP_005244902.1 |
SCAMP3 - secretory carrier membrane protein 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_005698.3 | Intron | NP_005689.2 | ||||
NM_052837.2 | Intron | NP_443069.1 | ||||
XM_006711105.3 | Intron | XP_006711168.1 | ||||
XM_006711106.3 | Intron | XP_006711169.1 | ||||
XM_016999991.1 | Intron | XP_016855480.1 |