Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCAGCACGTCACTGATGAAGGTCTC[C/G]TAGCGCAGCACTTTCTCCCCCGTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 311040 MIM: 300234 | ||||||||||||||||||||
Literature Links: |
ELK1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ELK1 - ELK1, ETS transcription factor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
UXT - ubiquitously expressed prefoldin like chaperone | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004182.3 | 313 | Silent Mutation | TAC,TAG | Y,* 20 | NP_004173.1 | |
NM_153477.2 | 313 | Silent Mutation | TAC,TAG | Y,* 32 | NP_705582.1 |
UXT-AS1 - UXT antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |