Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CGGGTTCAAAGGTCATCAACACCTC[C/G]ACGGTGTCTGGGTCCACAGGGCTGG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604644 MIM: 124097 MIM: 607092 | ||||||||||||||||||||
Literature Links: |
CA11 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CA11 - carbonic anhydrase 11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DBP - D-box binding PAR bZIP transcription factor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001352.4 | 851 | Silent Mutation | GTC,GTG | V,V 199 | NP_001343.2 | |
XM_017026388.1 | 851 | Silent Mutation | GTC,GTG | V,V 56 | XP_016881877.1 |
SEC1P - secretory blood group 1, pseudogene | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SPHK2 - sphingosine kinase 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |