Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCTTAGGTTTCCGTTCAGCCGCCCG[C/G]AGCTGCTGAAGGAATGGGTGCTGAA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
10 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 614827 MIM: 612532 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DNAJC11 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DNAJC11 - DnaJ heat shock protein family (Hsp40) member C11 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PHF13 - PHD finger protein 13 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
THAP3 - THAP domain containing 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001195752.1 | 121 | Intron | NP_001182681.1 | |||
NM_001195753.1 | 121 | Intron | NP_001182682.1 | |||
NM_138350.3 | 121 | Missense Mutation | CAG,GAG | Q,E 32 | NP_612359.2 | |
XM_005263532.3 | 121 | Missense Mutation | CAG,GAG | Q,E 32 | XP_005263589.1 | |
XM_011542400.2 | 121 | Intron | XP_011540702.1 | |||
XM_011542401.2 | 121 | Intron | XP_011540703.1 | |||
XM_017002761.1 | 121 | Missense Mutation | CAG,GAG | Q,E 32 | XP_016858250.1 |