Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGCGGGAGGTGGGGCGGTGACTCA[C/G]GCAGGCCTGGAGAGGGCTCTGCTGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601437 | ||||||||||||||||||||
Literature Links: |
FCGRT PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FCGRT - Fc fragment of IgG receptor and transporter | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RCN3 - reticulocalbin 3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_020650.2 | Intron | NP_065701.2 | ||||
XM_005259089.3 | Intron | XP_005259146.1 | ||||
XM_011527143.1 | Intron | XP_011525445.1 | ||||
XM_017027023.1 | Intron | XP_016882512.1 |