Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCAGAGGCGGACGCCGCAGCAGCA[A/G]CCTTCCGGGCAAACGGTAACTGCAC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 606999 MIM: 600939 MIM: 601978 | ||||||||||||||||||||
Literature Links: |
GALT PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GALT - galactose-1-phosphate uridylyltransferase | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_000155.3 | 183 | Missense Mutation | ACC,GCC | T,A 23 | NP_000146.2 | |
NM_001258332.1 | 183 | UTR 5 | NP_001245261.1 |
IL11RA - interleukin 11 receptor subunit alpha | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SIGMAR1 - sigma non-opioid intracellular receptor 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |