Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GATGAATCTTATCTATTTAACCAGA[A/T]GATAACCTCCAAGTTCAAGTATTTC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614240 MIM: 602138 MIM: 615588 | ||||||||||||||||||||
Literature Links: |
FAM109B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM109B - family with sequence similarity 109 member B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NDUFA6 - NADH:ubiquinone oxidoreductase subunit A6 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_002490.3 | Intron | NP_002481.2 |
NDUFA6-AS1 - NDUFA6 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SMDT1 - single-pass membrane protein with aspartate rich tail 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |