Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGGAAGATCAGCCCCAGCACGAAG[A/C]CTCCAACGCCACTCAGCATCTTGCT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 146880 MIM: 604305 | ||||||||||||||||||||
Literature Links: |
HLA-DQA1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
HLA-DQA1 - major histocompatibility complex, class II, DQ alpha 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HLA-DQB1 - major histocompatibility complex, class II, DQ beta 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001243961.1 | 792 | Missense Mutation | GGC,GTC | G,V 237 | NP_001230890.1 | |
NM_001243962.1 | 792 | Missense Mutation | GGC,GTC | G,V 237 | NP_001230891.1 | |
NM_002123.4 | 792 | Missense Mutation | GGC,GTC | G,V 237 | NP_002114.3 |
HLA-DQB1-AS1 - HLA-DQB1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |