Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TGGGCACCTGGCCCTCGCTGGTTTT[C/T]TGATCCTAACCAGCTTCTCCTCTTA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 176885 | ||||||||||||||||||||
Literature Links: |
FAM65C PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM65C - family with sequence similarity 65 member C | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001290268.1 | Intron | NP_001277197.1 | ||||
NM_080829.3 | Intron | NP_543019.2 | ||||
XM_005260294.3 | Intron | XP_005260351.1 | ||||
XM_006723713.3 | Intron | XP_006723776.1 | ||||
XM_011528578.2 | Intron | XP_011526880.1 | ||||
XM_011528579.2 | Intron | XP_011526881.1 | ||||
XM_011528580.2 | Intron | XP_011526882.1 | ||||
XM_011528581.2 | Intron | XP_011526883.1 | ||||
XM_011528584.2 | Intron | XP_011526886.1 | ||||
XM_011528585.2 | Intron | XP_011526887.1 | ||||
XM_011528586.2 | Intron | XP_011526888.1 | ||||
XM_017027681.1 | Intron | XP_016883170.1 | ||||
XM_017027682.1 | Intron | XP_016883171.1 |
MIR645 - microRNA 645 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PTPN1 - protein tyrosine phosphatase, non-receptor type 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |