Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AAGGCCCAGGCTTGAGCTGGGTAGC[A/C]CCATTTCTGTGGATGGGGAAGGAGT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 103280 MIM: 615509 MIM: 600789 | ||||||||||||||||||||
Literature Links: |
H19 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
H19 - H19, imprinted maternally expressed transcript (non-protein coding) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
HOTS - H19 opposite tumor suppressor | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001293171.2 | Intron | NP_001280100.1 |
LINC01219 - long intergenic non-protein coding RNA 1219 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR675 - microRNA 675 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MRPL23 - mitochondrial ribosomal protein L23 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_021134.3 | Intron | NP_066957.3 | ||||
XM_006718271.2 | Intron | XP_006718334.1 | ||||
XM_011520273.1 | Intron | XP_011518575.1 | ||||
XM_011520275.2 | Intron | XP_011518577.1 | ||||
XM_011520276.2 | Intron | XP_011518578.1 |
MRPL23-AS1 - MRPL23 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |