Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AGTATATATATATGTATGTGGCATA[A/G]ATATATACTGATATGGGTATAGATA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 611643 MIM: 616474 | ||||||||||||||||||||
Literature Links: |
NKAPL PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
NKAPL - NFKB activating protein like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZKSCAN4 - zinc finger with KRAB and SCAN domains 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZSCAN26 - zinc finger and SCAN domain containing 26 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001023560.3 | Intron | NP_001018854.2 | ||||
NM_001111039.2 | Intron | NP_001104509.1 | ||||
NM_001287421.1 | Intron | NP_001274350.1 | ||||
NM_001287422.1 | Intron | NP_001274351.1 | ||||
NM_152736.5 | Intron | NP_689949.3 | ||||
XM_011514862.2 | Intron | XP_011513164.1 | ||||
XM_011514864.1 | Intron | XP_011513166.1 | ||||
XM_011514866.1 | Intron | XP_011513168.1 | ||||
XM_011514867.1 | Intron | XP_011513169.1 | ||||
XM_011514869.1 | Intron | XP_011513171.1 | ||||
XM_017011264.1 | Intron | XP_016866753.1 | ||||
XM_017011265.1 | Intron | XP_016866754.1 |