Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCATTTCAATCATCCCCTTTTTGT[C/G]TGATTAAACTGTCAGCTCTTTGAAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 603846 MIM: 609538 | ||||||||||||||||||||
Literature Links: |
FAM180B PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FAM180B - family with sequence similarity 180 member B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
KBTBD4 - kelch repeat and BTB domain containing 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001318716.1 | Intron | NP_001305645.1 | ||||
NM_001318717.1 | Intron | NP_001305646.1 | ||||
NM_001318718.1 | Intron | NP_001305647.1 | ||||
NM_001318719.1 | Intron | NP_001305648.1 | ||||
NM_001318720.1 | Intron | NP_001305649.1 | ||||
NM_001318721.1 | Intron | NP_001305650.1 | ||||
NM_001318722.1 | Intron | NP_001305651.1 | ||||
NM_001318723.1 | Intron | NP_001305652.1 | ||||
NM_001318724.1 | Intron | NP_001305653.1 | ||||
NM_001318725.1 | Intron | NP_001305654.1 | ||||
NM_016506.6 | Intron | NP_057590.3 | ||||
NM_018095.5 | Intron | NP_060565.4 | ||||
XM_017018009.1 | Intron | XP_016873498.1 |
NDUFS3 - NADH:ubiquinone oxidoreductase core subunit S3 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004551.2 | Intron | NP_004542.1 |
PTPMT1 - protein tyrosine phosphatase, mitochondrial 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |