Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCTATCAGTTTCCACACATCAGCC[A/G]TCTTTAATTACTAACACAATTCCTA
Species: |
Human | |||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
28 submissions
|
|||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607245 MIM: 609683 | |||||||||||||||||||||||||||||||||||||||||
Literature Links: |
AP4B1 PubMed Links | |||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | ||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | ||||||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | ||||||
EUR
|
||||||||
AMR
|
AP4B1 - adaptor related protein complex 4 beta 1 subunit | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001253852.2 | 2223 | UTR 3 | NP_001240781.1 | |||
NM_001253853.2 | 2223 | UTR 3 | NP_001240782.1 | |||
NM_001308312.1 | 2223 | UTR 3 | NP_001295241.1 | |||
NM_006594.4 | 2223 | UTR 3 | NP_006585.2 | |||
XM_011540523.2 | 2223 | Intron | XP_011538825.1 | |||
XM_011540524.2 | 2223 | Intron | XP_011538826.1 | |||
XM_011540525.2 | 2223 | Intron | XP_011538827.1 | |||
XM_011540528.2 | 2223 | Intron | XP_011538830.1 | |||
XM_017000088.1 | 2223 | Intron | XP_016855577.1 | |||
XM_017000089.1 | 2223 | Intron | XP_016855578.1 | |||
XM_017000090.1 | 2223 | Intron | XP_016855579.1 | |||
XM_017000091.1 | 2223 | Intron | XP_016855580.1 | |||
XM_017000092.1 | 2223 | Intron | XP_016855581.1 | |||
XM_017000093.1 | 2223 | Intron | XP_016855582.1 |
AP4B1-AS1 - AP4B1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
BCL2L15 - BCL2 like 15 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
DCLRE1B - DNA cross-link repair 1B | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |