Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GCATTCCAATAGCTGTGCAGCGTAT[C/T]TGCTCTCTGCGGCACCCACGTTTTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607477 | ||||||||||||||||||||
Literature Links: |
GTSE1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GTSE1 - G2 and S-phase expressed 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_016426.6 | Intron | NP_057510.4 | ||||
XM_005261627.3 | Intron | XP_005261684.1 | ||||
XM_011530211.2 | Intron | XP_011528513.1 | ||||
XM_011530213.2 | Intron | XP_011528515.1 | ||||
XM_017028815.1 | Intron | XP_016884304.1 | ||||
XM_017028816.1 | Intron | XP_016884305.1 |
GTSE1-AS1 - GTSE1 antisense RNA 1 (head to head) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TTC38 - tetratricopeptide repeat domain 38 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |