Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TATAGCAGATCTCTGGCACTGATTC[A/T]TCTTGTATAATTGAAACTTTATGCC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 610966 MIM: 610937 | ||||||||||||||||||||
Literature Links: |
FTO PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
FTO - fat mass and obesity associated | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001080432.2 | Intron | NP_001073901.1 | ||||
XM_011523313.2 | Intron | XP_011521615.1 | ||||
XM_011523314.2 | Intron | XP_011521616.1 | ||||
XM_011523315.2 | Intron | XP_011521617.1 | ||||
XM_011523316.2 | Intron | XP_011521618.1 | ||||
XM_017023654.1 | Intron | XP_016879143.1 | ||||
XM_017023655.1 | Intron | XP_016879144.1 | ||||
XM_017023656.1 | Intron | XP_016879145.1 | ||||
XM_017023657.1 | Intron | XP_016879146.1 | ||||
XM_017023658.1 | Intron | XP_016879147.1 |
RPGRIP1L - RPGRIP1 like | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |