Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGTTGGTGATCTAAAGGAGTGCTT[C/T]TCAACCACGGCCCACACAGTCACTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 600463 MIM: 610986 | ||||||||||||||||||||
Literature Links: |
ALDH1A3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ALDH1A3 - aldehyde dehydrogenase 1 family member A3 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC101927751 - uncharacterized LOC101927751 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LRRK1 - leucine rich repeat kinase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_024652.4 | Intron | NP_078928.3 | ||||
XM_005254979.3 | Intron | XP_005255036.1 | ||||
XM_011522012.2 | Intron | XP_011520314.1 | ||||
XM_011522013.2 | Intron | XP_011520315.1 | ||||
XM_011522014.2 | Intron | XP_011520316.1 | ||||
XM_011522015.2 | Intron | XP_011520317.1 | ||||
XM_011522016.2 | Intron | XP_011520318.1 | ||||
XM_011522017.2 | Intron | XP_011520319.1 | ||||
XM_011522018.2 | Intron | XP_011520320.1 | ||||
XM_011522019.2 | Intron | XP_011520321.1 | ||||
XM_017022570.1 | Intron | XP_016878059.1 |