Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACAACAAAAAACTATACAATAGAGA[C/T]AGTTTATGGCCCACAATTCCTACAA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
56 submissions
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 607112 MIM: 609111 MIM: 605647 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
FBXO2 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
FBXO2 - F-box protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
FBXO44 - F-box protein 44 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001014765.1 | Intron | NP_001014765.1 | ||||
NM_001304790.1 | Intron | NP_001291719.1 | ||||
NM_001304791.1 | Intron | NP_001291720.1 | ||||
NM_033182.5 | Intron | NP_149438.2 | ||||
NM_183412.2 | Intron | NP_904319.1 | ||||
NM_183413.2 | Intron | NP_904320.1 | ||||
XM_005263535.1 | Intron | XP_005263592.1 | ||||
XM_005263536.4 | Intron | XP_005263593.1 | ||||
XM_005263537.1 | Intron | XP_005263594.1 | ||||
XM_006711043.2 | Intron | XP_006711106.1 | ||||
XM_006711045.2 | Intron | XP_006711108.1 | ||||
XM_011542435.1 | Intron | XP_011540737.1 | ||||
XM_017002842.1 | Intron | XP_016858331.1 | ||||
XM_017002843.1 | Intron | XP_016858332.1 | ||||
XM_017002844.1 | Intron | XP_016858333.1 |
FBXO6 - F-box protein 6 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |