Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
AACTGGGCAGCCCTTTCACAGCTCC[A/G]GCTGATTGTTGCCTTGCGACAATAT
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 158070 MIM: 603222 MIM: 603223 MIM: 603224 MIM: 603225 MIM: 603226 MIM: 603227 MIM: 603228 MIM: 603229 MIM: 603230 | ||||||||||||||||||||
Literature Links: |
SLC3A2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
SLC3A2 - solute carrier family 3 member 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNHG1 - small nucleolar RNA host gene 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD22 - small nucleolar RNA, C/D box 22 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD25 - small nucleolar RNA, C/D box 25 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD26 - small nucleolar RNA, C/D box 26 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD27 - small nucleolar RNA, C/D box 27 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD28 - small nucleolar RNA, C/D box 28 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD29 - small nucleolar RNA, C/D box 29 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD30 - small nucleolar RNA, C/D box 30 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD31 - small nucleolar RNA, C/D box 31 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |