Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CAGCCCCCGCGCCCCACCGCGCGTC[C/T]TACAAGCCGGTCATCGTGGTGCATG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 609897 MIM: 603298 | ||||||||||||||||||||
Literature Links: |
EGFL8 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
EGFL8 - EGF like domain multiple 8 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC100507547 - uncharacterized LOC100507547 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PPT2 - palmitoyl-protein thioesterase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001204103.1 | 509 | Silent Mutation | TCC,TCT | S,S 35 | NP_001191032.1 | |
NM_005155.6 | 509 | Silent Mutation | TCC,TCT | S,S 35 | NP_005146.4 | |
NM_138717.2 | 509 | Silent Mutation | TCC,TCT | S,S 41 | NP_619731.2 |
PPT2-EGFL8 - PPT2-EGFL8 readthrough (NMD candidate) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PRRT1 - proline rich transmembrane protein 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |