Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CTTGGGGACTTGTTTCTTCCCTACC[C/G]CCGCGCCATCCATTCGTTTATCCGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 607434 MIM: 612648 | ||||||||||||||||||||
Literature Links: |
GTPBP2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
GTPBP2 - GTP binding protein 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MAD2L1BP - MAD2L1 binding protein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001003690.1 | Intron | NP_001003690.1 | ||||
NM_014628.2 | Intron | NP_055443.1 |
RSPH9 - radial spoke head 9 homolog | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |