Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
CCCCCAGCACATTTATGGCCTTGCA[G/T]GTGTAGACCCCAGAATCAAAGGGGC
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
1 submissions
|
||||||||||||||||||||
Phenotype: |
MIM: 102775 MIM: 601525 MIM: 160795 | ||||||||||||||||||||
Literature Links: |
ADORA1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
ADORA1 - adenosine A1 receptor | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
CHI3L1 - chitinase 3 like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MYBPH - myosin binding protein H | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004997.2 | 1418 | Silent Mutation | ACA,ACC | T,T 453 | NP_004988.2 |