Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TCCATAGACTATCTTATGATTTAAT[A/G]CTCCTATGAATATCTACATCAACTG
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
24 submissions
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 609908 MIM: 604227 MIM: 605667 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
APOBEC4 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
APOBEC4 - apolipoprotein B mRNA editing enzyme catalytic polypeptide like 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ARPC5 - actin related protein 2/3 complex subunit 5 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RGL1 - ral guanine nucleotide dissociation stimulator like 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001297669.1 | Intron | NP_001284598.1 | ||||
NM_001297670.1 | Intron | NP_001284599.1 | ||||
NM_001297671.1 | Intron | NP_001284600.1 | ||||
NM_001297672.1 | Intron | NP_001284601.1 | ||||
NM_015149.4 | Intron | NP_055964.3 | ||||
XM_011509339.2 | Intron | XP_011507641.1 | ||||
XM_011509341.1 | Intron | XP_011507643.1 | ||||
XM_011509342.2 | Intron | XP_011507644.1 | ||||
XM_017000756.1 | Intron | XP_016856245.1 |
Set Membership: |
HapMap |