Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTCTTGAGGATGCCAGAGGAGGCAC[C/T]GGTGGGGCCAGGTCCCTGCGGCCCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
11 submissions
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 614282 MIM: 603905 MIM: 600315 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
SDF4 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
SDF4 - stromal cell derived factor 4 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFRSF18 - TNF receptor superfamily member 18 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TNFRSF4 - TNF receptor superfamily member 4 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_003327.3 | 88 | Intron | NP_003318.1 | |||
XM_011542074.2 | 88 | Intron | XP_011540376.1 | |||
XM_011542075.2 | 88 | Intron | XP_011540377.1 | |||
XM_011542076.2 | 88 | Intron | XP_011540378.1 | |||
XM_011542077.2 | 88 | Missense Mutation | AGT,GGT | S,G 12 | XP_011540379.1 | |
XM_017002231.1 | 88 | Intron | XP_016857720.1 | |||
XM_017002232.1 | 88 | Intron | XP_016857721.1 |