Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
TTGTCTAGTTTGAAGATTCTTGGTA[C/G]TATATTTAGTTTCTAGGTGAAGAAA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604508 MIM: 137028 | ||||||||||||||||||||
Literature Links: |
COPS2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
COPS2 - COP9 signalosome subunit 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
GALK2 - galactokinase 2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001001556.2 | Intron | NP_001001556.1 | ||||
NM_001289030.1 | Intron | NP_001275959.1 | ||||
NM_001289031.1 | Intron | NP_001275960.1 | ||||
NM_002044.3 | Intron | NP_002035.1 | ||||
XM_005254279.3 | Intron | XP_005254336.1 | ||||
XM_005254280.3 | Intron | XP_005254337.1 | ||||
XM_005254284.3 | Intron | XP_005254341.1 | ||||
XM_006720461.3 | Intron | XP_006720524.1 | ||||
XM_006720462.3 | Intron | XP_006720525.1 | ||||
XM_006720463.3 | Intron | XP_006720526.1 | ||||
XM_006720464.3 | Intron | XP_006720527.1 | ||||
XM_011521441.2 | Intron | XP_011519743.1 | ||||
XM_017022062.1 | Intron | XP_016877551.1 | ||||
XM_017022063.1 | Intron | XP_016877552.1 | ||||
XM_017022064.1 | Intron | XP_016877553.1 | ||||
XM_017022065.1 | Intron | XP_016877554.1 | ||||
XM_017022066.1 | Intron | XP_016877555.1 |
MIR4716 - microRNA 4716 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NDUFAF4P1 - NADH:ubiquinone oxidoreductase complex assembly factor 4 pseudogene 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |