Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
ACCCACACTCACCCAGATCTTGATG[A/C]TGGGGCCTGTGGCAGCACACAGCCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 176981 MIM: 610530 | ||||||||||||||||||||
Literature Links: |
CTC-338M12.4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
CTC-338M12.4 - uncharacterized LOC101928649 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
RACK1 - receptor for activated C kinase 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006098.4 | 870 | Missense Mutation | AGC,ATC | S,I 255 | NP_006089.1 |
SNORD95 - small nucleolar RNA, C/D box 95 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD96A - small nucleolar RNA, C/D box 96A | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
TRIM41 - tripartite motif containing 41 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |